Summary
In many species, individuals prefer mates that are genetically dissimilar at the major histocompatibility complex (MHC), likely because it improves offspring resistance to pathogens. Here, we provide the first characterization of the MHC class II peptide binding region in bluegill (Lepomis macrochirus) and examine its effect on mating patterns. We captured female and male bluegill during spawning and sequenced these fish at the MHC. We found strong evidence that positive selection promotes genetic diversity at the MHC in bluegill, with a 5:2 ratio of non-synonymous to synonymous mutations. However, we found no evidence that the MHC led to disassortative mating between females and parental males. Extra-pair mating and the presence of specialized cuckolder males may have an important, albeit still unresolved, role in shaping mating patterns at the MHC in bluegill.
Methodology
Study species and sample collection
Sample collection occurred at the Queen’s University Biological Station (QUBS) on Lake Opinicon (44.5° N, 76.3° W). In the summer of 2015, a 6-km transect along the shoreline of Lake Opinicon was swam daily by a group of divers to identify the formation of colonies and the arrival of breeding females, which marked the beginning of a spawning bout at that colony. On the day that spawning activity was first observed at a colony, divers floated motionless over the colony to observe the activity and watch for females entering nests. Spawning pairs were observed until a female visibly dipped, a movement where the female tips onto her side and releases a small batch of her eggs into a parental male’s nest. Once dipping was observed at least five consecutive times between a pair, both parental male and female were caught with a dip net. This dipping threshold was used to ensure that the female had mated with the parental male and was not in his nest solely to evaluate him as a potential mate. A female bluegill may mate with multiple males during one or more breeding bouts, and a parental male’s nest often contains eggs from multiple females (Neff 2001). A mesh cover was then placed over the male’s nest to protect the eggs from predation by other fish. The nest was also marked with a uniquely numbered ceramic tile to allow for identification of the nest. The mating pair was then brought to a boat where total body length was recorded and a small fin clip was removed from each fish’s caudal fin and stored in 95% ethanol for later genetic analysis. Both fish were then returned to the water and the cover was removed from the parental male’s nest. Parental males typically returned to their nests immediately and commenced courting other females. Occasionally, a previously caught parental male (identified by nest tile and fin clip) was recaptured with a new female (identified by the absence of a fin clip), or two females were captured while simultaneously mating with a parental male. In these cases, each parental male-female pairing was treated as a novel pair (5 of 35 pairs in our sample were comprised of previously caught males). In addition to spawning pairs that contained a parental male and female, we also captured four sneakers in the act of spawning and collected a fin clip from these fish. A total of 69 bluegill (30 parental males, 35 females, 4 cuckolders) were thus included in our study. To minimize observer bias, blinded methods were used such that the identities of mating pairs were not known at the time of the genetic analysis.
MHC primer design and sequencing
Primers for amplification of MHC II in bluegill were designed based on sequences from a bluegill brain transcriptome (Partridge et al. 2016). Briefly, Partridge et al. (2016) used high-throughput sequencing to characterize the sequences of expressed transcripts from the brains of 20 bluegill collected in Lake Opinicon. The resulting transcriptome consisted of 235,547 transcripts. Using the transcriptome as a local database, NCBI BLAST was used to search for potential MHC class II putative peptide binding region sequences by using known MHC sequences from striped sea bass (Morone saxatilis, Genbank id: L33967) and three-spined stickleback (Gasterosteus aculeatus, Genbank id: DQ016429). Probing the transcriptome for exon 2 of MHC class II with these sequences yielded a single transcript in bluegill. Using the bluegill MHC II transcript sequence, Primer-Blast was used to develop a primer pair (forward: GCATTCCTCAGTGGTCCGC and reverse: TGTACCAGTTCCCAATGTTG) that spanned a 239 base pair region of the putative MHC II locus.
To test the MHC II primers, DNA was first extracted from bluegill fin clips via Proteinase K digestion and ethanol precipitation (Neff et al. 2000). Next, DNA from three parental males was amplified at the MHC using polymerase chain reaction (PCR). The PCR amplicon was cloned using a pGEM T-easy vector kit following manufacturer’s instructions (Promega Corp, Madison, Wisconsin) and used to transform Escherichia coli, which were then grown on lysogeny broth agar plates. Bacterial colonies containing the insert were collected and re-amplified using the sequencing primers SP6 and T7. Eight insert-containing colonies from three individuals were sequenced by the London Regional Genomics Centre (London, Ontario). The resulting sequences were analysed with NCBI BLAST, which confirmed that the bluegill MHC amplicon had high similarity to the putative peptide binding region of MHC class II in other teleost fishes, including 88% identity with striped sea bass and 87% identity with orange-spotted grouper (Epinephelus coioides). Bluegill MHC sequences were then aligned with the human MHC class II peptide binding region to identify the specific amino acid positions likely to comprise the key residues of the pathogen peptide binding region following the X-ray crystallography determinations of Brown et al. (1993).